padR [2017-11-15 12:55:10]

repressor of yveF-yveG-padC, induction occurs by binding of phenolic acids,stress response

locus: BSU08340

pI: 7.23

mw: 21.08 kDa

protein length: 182 aa

gene length: 546 bp

function: regulation of the phenolic acid stress response

product: transcriptional repressor

essential: no

synonyms: yfiO

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]

Gene

Coordinates: 909,198 → 909,746

The protein

Effectors of protein activity

• phenolic acid acts as molecular inducer and releases PadR from the'' [gene|1E0BA378F14ADF03D613DA3BF3241C1ADE75075E|yveF]-[gene|1F56C126099E1D5241069E06477F277C12B20C58|yveG]-[gene|ECA64CB1E4BF8B6B0854B1B63C9E85A519059C6C|padC]'' promoter [Pubmed|18326577]

[SW|Localization]

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• genes: [gene|A7824EACE0C109C676A374FD21F59D671B703305|padR]
  description: [pubmed|22383849]

  regulation

  • weak constitutive expression

Biological materials

Mutant

• MGNA-C303 (yfiO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2301 NBRP B. subtilis, Japan]
• BKE08340 (Δ[gene|A7824EACE0C109C676A374FD21F59D671B703305|padR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATCCTCCGTGTCTG, downstream forward: _UP4_TAACCGCAGTTCAGGCTGCA
• BKK08340 (Δ[gene|A7824EACE0C109C676A374FD21F59D671B703305|padR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATCCTCCGTGTCTG, downstream forward: _UP4_TAACCGCAGTTCAGGCTGCA

References

• 18326577,21685295